This is an actual post for the class this blog was originally for. So some of you may want to ignore this, but if you want to read on, feel free.
Let's consider three patients: Abby, Bob, and Carol. Their DNA sequences for a particular region of the sequences can be compared to the normal sequence for this region:
ATGGTCCACCTGACTCCTGAGGAGAAGTCTGCC
Each patient has a variant of this.
Abby:
ATGGTCCACCTGACTCCTGAGGTGAAGTCTGCC
Bob:
ATGGTCCACCTGACTCCTGAGGAGTAGTCTGCC
Carol:
ATGGTGCACCTGACCCTGAGCAGAAGTCTGCCC
Each patient has a certain percentage of similarity between their DNA sequence and the normal DNA sequence. For example, Abby's DNA is approximately 96.97% similar to the normal, as is Bob's. Carol, however, has only a 57.58% similarity (assuming order is the only factor considered).
Then, each of these has another side of the chain--its complement. Now, we know that the ratio of adenine to thymine and cytosine to guanine is 1:1. But this raises two questions: "Why?" and "How did we know this?"
So why? Basically, hydrogen bonds could not form between, say, A and C, or if they did they would be extremely unstable.
Now, how was this originally discovered?
It's a principle known as one of Chargaff's rules and was discovered by Erwin Chargaff. It says that the ratio of purines to pyrimidines (and more specifically, A to T and C to G) is always constant within a species. He discovered this by looking at data similar to the below image:
By analyzing this data, it's not too hard to see that there does seem to be the same amount of adenine and thymine, and cytosine and guanine, within a certain strand of DNA. For example, a rat's DNA seems to be made up of 28.6% adenine and 28.4% thymine, and 21.4% guanine and 21.6% cytosine. As all of these numbers seem to be essentially equal, allowing for experimental error, for all double-stranded DNA organisms, it seems quite reasonable to conclude that there is a fixed ratio of these bases. In addition, we also notice that there is an equal division of purines to pyrimidine bases.
Let's consider three patients: Abby, Bob, and Carol. Their DNA sequences for a particular region of the sequences can be compared to the normal sequence for this region:
ATGGTCCACCTGACTCCTGAGGAGAAGTCTGCC
Each patient has a variant of this.
Abby:
ATGGTCCACCTGACTCCTGAGGTGAAGTCTGCC
Bob:
ATGGTCCACCTGACTCCTGAGGAGTAGTCTGCC
Carol:
ATGGTGCACCTGACCCTGAGCAGAAGTCTGCCC
Each patient has a certain percentage of similarity between their DNA sequence and the normal DNA sequence. For example, Abby's DNA is approximately 96.97% similar to the normal, as is Bob's. Carol, however, has only a 57.58% similarity (assuming order is the only factor considered).
Then, each of these has another side of the chain--its complement. Now, we know that the ratio of adenine to thymine and cytosine to guanine is 1:1. But this raises two questions: "Why?" and "How did we know this?"
So why? Basically, hydrogen bonds could not form between, say, A and C, or if they did they would be extremely unstable.
Now, how was this originally discovered?
It's a principle known as one of Chargaff's rules and was discovered by Erwin Chargaff. It says that the ratio of purines to pyrimidines (and more specifically, A to T and C to G) is always constant within a species. He discovered this by looking at data similar to the below image:
By analyzing this data, it's not too hard to see that there does seem to be the same amount of adenine and thymine, and cytosine and guanine, within a certain strand of DNA. For example, a rat's DNA seems to be made up of 28.6% adenine and 28.4% thymine, and 21.4% guanine and 21.6% cytosine. As all of these numbers seem to be essentially equal, allowing for experimental error, for all double-stranded DNA organisms, it seems quite reasonable to conclude that there is a fixed ratio of these bases. In addition, we also notice that there is an equal division of purines to pyrimidine bases.
No comments:
Post a Comment