"Even our brightest students..." Part II

In a recent post, I spent a lot of time criticizing the attitudes of students--including myself. Even back then, I knew that I was being pretty pessimistic about the future, and that bothered me.

So I tried to find out if my outlook was accurate.

A few things I should say before I start:

The students that I work with have only had--at most--two flavors of standards-based grading. Whenever I refer to SBG in this post, I'm generally referring to Chris Ludwig's approach, because that's the one I've seen in action and debated.

With that out of the way...here's what I've found:

1. Some students agree with me--even though SBG is preferable to a points-based system, it wouldn't be widely accepted.

2. Some students don't like SBG. Period.

So, basically...nothing new. I've been hearing both of those all year, typically when I'm, for some reason, describing SBG in a group setting--and someone else jumps in and says either:

"Yes! I really like standards-based grades!" and then goes on to explain why, or the student will say:

"But standards-based grading [is confusing/kills my grade/is hard]!"

Why is that second response even there? I think the answer is quite simple: students on the whole--especially after over ten years of grades--are so used to viewing a single letter grade as an achievement or as something that communicates some sort of information about them that many simply don't get why that's really not the case.

What I'm about to say has been said many times, but in a summative system--which is basically all I've seen for the past eleven years--grades are developed by building points that often become meaningless. I've heard teachers say, "Now, if you can just remember that the answer to Question 14 is C., you'll get more points for the test." And before this year, I didn't really have a problem with that. But when grades simply become who brought in the most Kleenex and could remember certain answers to a test (and, of course, forget them five minutes later) it's ridiculous to think that they have any meaning.

And the more I think, the more I believe that some students really don't want them to. After all, when we're signing up for the ACT and the SAT (and, after all, that's our only chance to get into a good college), we meet pages like:

 and

 

Since grades obviously matter so much, students have to get the best ones they can! Right? RIGHT?!?

Now, those of you with incredible memories will recall that, at the beginning of this rambling, I mentioned that there are some students who agree with me--that SBG is preferable to a summative system. And it's these guys that give me hope. I look around and I see classmates' posts (like this one and this one) and I realize that SBG really did bring out a different level of learning in many students--and that they appreciate it.

Students like those two--self-motivated and willing to adapt--are the only reason I believe there is a chance for SBG to become widespread. They know about this idea, support it, and hopefully they will continue to spread it in discussions, like I've been trying to do all year. After all, many people do not know about these non-traditional grading/instruction methods--as I've said before, before the 2010-2011 school year, I had never considered either.¹
 

Ok, I've rambled enough by now. Seriously, though, if you don't think I'm giving an accurate representation of students, yell at me. On this issue particularly, I really want to know what you think.

---

1. Of course, some may suggest that teachers should be forced to use SBG so that we can let more people know about it. I disagree, because I think that, if a teacher is going to make this change, they should make it because they understand the reasons behind it--because they truly believe that the conventional method of assessment is flawed.

The "Most Beautiful" Experiment

I'm pretty sure that this will be the last biology post on this blog. You can interpret that as a good thing or a bad thing...I won't tell you which one I think it is.

---

It's been called the most beautiful experiment in biology. It's just one of those things that it seems like everyone knows about.

I'm referring to, of course, the Meselson-Stahl experiment, showing that DNA replication is semi-conservative.

This experiment's original purpose was to provide data regarding the process of replication of DNA. Watson and Crick's model suggested a way that DNA could replicate, but there wasn't actual information regarding this. So, a few years after Watson and Crick published their model, Meselson and Stahl set out to conclusively establish the method through which DNA replicated.

There were actually several potential models. For example, a DNA molecule could somehow create an entirely new DNA molecule. Or, parts of the DNA could be interspersed with new DNA.

Although Watson and Crick seemed to support the semi-conservative model, where half of the DNA was preserved and the other half was newly created, this model, like all others, was not supported. Meselson and Stahl found a way to provide this support. Here's how:

The key to their experiment was finding a way to tell whether DNA was "old" or newly created, and this was found by labeling the DNA when it was first created. In essence, this was done by growing E. coli bacteria when it was contained in a heavy isotope of nitrogen and another culture in the presence of the ordinary isotope.

After several generations, the bacteria's DNA contained one of the two isotopes of nitrogen. Samples of both cultures--one with the heavy nitrogen, one with the normal--were taken, and the DNA was removed. The DNA from both samples was mixed together, and this solution was mixed with a cesium salt solution which had the same density as DNA.

This final solution of salt and DNA was centrifuged until the cesium ions formed a sediment at the bottom of the tube, causing the solution to be more dense at the bottom than the top. This meant that the DNA formed bands within the tube, with the DNA containing the denser nitrogen closer to the bottom than the DNA with the more common nitrogen.

The process was repeated, but this time, some of the bacteria were allowed to grow in the lighter nitrogen for several generations. This meant that any newly created DNA would have this form of nitrogen included. For every twenty minutes, a sample was taken from this mix of DNA grown in both light and heavy nitrogen. DNA from these samples were centrifuged.

Here were the results: In the first sample (which did not grow in the light nitrogen) all of the DNA contained the "heavy" nitrogen. One generation later, the DNA had an intermediate density between the two. A generation after this, the DNA was half heavy and half light, and as more generations passed, the DNA contained less of the heavy and more of the light.

These results supported semi-conservative reproduction, because they show that part of the DNA is conserved from one generation to the next--otherwise, the DNA synthesized in the lighter nitrogen would only contain the light nitrogen. However, there has to be another part of the DNA that is newly synthesized, because the density of the DNA did not remain at the heavy end of the spectrum.

Now, this experiment is simply wonderfully designed. There was a need--a need to support a model of DNA reproduction, and the hypothesis of semi-conservative reproduction. To test this, there was a variable that was changed--the amount of time that the bacteria were allowed to reproduce within the lighter isotope of nitrogen. Everything else--the speed of the centrifuge, the type of bacteria, the amount of time the bacteria were allowed to grow--was kept constant. There was even a control group--the first group, which did not have any time within the lighter nitrogen.

If you have stayed with me all the way to this point, I want to thank you for putting up with these posts for this long. Although I may have rambled just a few times, and set the world record for worst procrastination, it has been a fun year within this class. 

Great American Teach In

What would a perfect learning space look like?

Before I start, I have a confession to make. That's actually a question I've honestly never really considered. I guess I've spent too much time reflecting on what my current learning space looks like--and how I want to make a different one in ten years--to even think about what I think it ought to look like now. There's my little bit of self-reflection done for the day.

---

So here's what's coming into my mind:

1. Students have a right to know about the various instruction methods available.

I guess this is really my third post (see here and here) in which this idea has made its appearance, but it's an important idea: There are large groups of people out there with no idea what project-based or inquiry-based learning are. Until this school year, I was one of them. I simply didn't know that there were better things out there that I could be getting. Therefore, I never asked for it.

2. Schools should be willing to work for students instead of vice versa when it comes to scheduling.

I know I'm not the only person to write a post on this idea, but it's another idea that matters a lot to me. Students have a certain path that they will end up following, and if this path involves going beyond the typical high school curriculum, they should be able to do it, regardless of "minimum graduation requirements," "only six classes a day," etc.

3. The methods used to assess students should truly assess skills and knowledge.

Oftentimes, students, including myself, get so caught up in what their grade is that we lose sight of whether or not we are truly learning. In a perfect learning system, there would be a correlation between the knowledge and the ways in which the students are objectified. (Of course, my perfect learning system would also be SBAR-based.)

4. Students have a responsibility to provide feedback to their teachers.

Let's be honest: I belong to a generation that, as a whole, is not famous for its communication skills.We (at least around here) need to work on calmly addressing teachers when we have a complaint instead of telling peers about how evil that teacher in Room 304 is.

5. Class sizes are small.

My fourth hour, with Chris Ludwig, has about twenty-five students. Sixth hour is next door, so I often step into his class during this time. On a normal day, there's about ten kids in there, but only three today because all of our seniors are essentially gone. And the one thing that really hit me was the incredible change in atmosphere from fourth hour. It's so much more laid back, relaxed, and open--and it really is a preferable change.

This Post's Title Keeps Evolving, So I'll Just Call It This

I just scrolled through my Twitter stream, and just over the most recent tweets, I saw multiple tweets devoted to just one idea:

#evolution

Although that may not sound too impressive--after all, I follow almost all science teachers--the fact that this one idea is still sparking debates and controversy after centuries of existence is actually pretty impressive when you stop to consider it. Simply clicking on the #evolution hashtag reveals a community that is updated at least once every five to ten minutes.

So what's the real idea behind evolutionary theory?

Let's go back to the beginning...although not the very beginning. Let's start in 1801, when John-Baptiste Lamarck published his Theory of Inheritance of Acquired Characteristics. Right away, if you have a background in evolutionary theory, an alarm bell will go off in your head. If you have that red flag, you've caught the big thing Lamarck got wrong. Lamarck thought that organisms could inherit acquired characteristics. For example, if a snake, throughout the course of its life, develops muscles that allow it to wriggle faster, Lamarck thought that it would pass those muscles on to its offspring.

Darwin didn't think that. He said that organisms pass on mutations, not acquired characteristics. And because organisms pass on mutations, if those mutations give an organism a certain competitive advantage, they have a better chance of producing more offspring. Those offspring may then have the same mutation, which gives them the same advantage over other organisms, giving them a better chance of producing more offspring. These offspring carry the mutation, which gives them an advantage...and the cycle continues.

Now, that's the basic mechanism of the theory of evolution--and it's known as natural selection. It's where phrases like "survival of the fittest" come from. However, that phrase isn't really accurate. Natural selection depends more upon reproduction than survival. Of course, survival helps to reproduce, but it does not guarantee offspring.

The classic, almost cliched, case of evidence for natural selection is the story of the peppered moths in Britain. There are two main phenotypes for this type of moth: light and dark. Before 1848, dark moths made up less than 2% of the total population. However, by 1898, over 95% of moths in industrialized areas were dark.

Why?

The mid-1800s was the time of the Industrial Revolution in Britain. All of those factories were emitting soot, so the landscape itself became somewhat darker. This meant that birds could see the lighter moths more frequently, and so the lighter moths were the ones that were eaten. The darker moths were able to reproduce, which produced more dark moths. Over a period of fifty years, the gene pool of the population changed, which is evolution by definition.

That is an example of microevolution--change within a species--and there are other ways in which this can occur. For example, let's spend some time talking about genetic drift. Genetic drift has to do with the change of the frequency of alleles due to random chance. Genetic drift holds more power in smaller populations, simply because even a slight change in the frequency can have an impact on the overall pool. Essentially, that means:

Genetic drift basically means that some random things will happen to a population to change its gene pool. It boils down to this: If a population is relatively small, then there is an increased chance that rare genotypes will not make it to the next generation.

There's another mechanism for microevolution--gene flow. (Don't worry--this one's much easier to understand than genetic drift!) All that gene flow says is that the migration of organisms has an effect on the gene pool. If two populations share an general boundary, there's nothing to stop them from interbreeding, introducing genes into the gene pool of both populations.



So, that's a little overview of microevolution--change within a species. Now, I realize that I've made some pretty big claims over the last few paragraphs. What evidence is there for those?

It turns out that there's a lot. First off, let's look at the fossil record. I've often been told that there simply aren't any intermediary fossils (fossils of animals that were "in between" species--they have features of both). And the more I research that claim, it's simply not true. For example, look at these fossils:

In these fossils, over a period of 50 million years, we can watch the nostrils move from the front of the skull to their current location at the top of the skull.

Another important branch of evidence for evolution is the idea of homologies. Homologous structures are structures that are shared across many species. For example, even though a cactus and a rose have very different structures that serve as leaves, they both have the same ultimate function. Another example of this is forelimbs among four-legged creatures. Even though, say, a rabbit and a lizard are clearly quite different, the bones within their forelimbs are constructed in the same manner.

Homologies can also be found at the cellular and molecular levels. For example, plant and animal cells are essentially identical--there are only two organelles in a plant cell that are not in an animal cell, and one animal organelle not in a plant. Additionally, a significant percentage of genes are shared across species. Just look at a roundworm and a human. Between those two phenotypically different species, 25% of genes are identical.

Finally, let's look at one more support column for the theory of evolution: the field of embryology. Basically, it says that, in their early stages, embryos of different vertebrates have strong similarities. This is taken to suggest that these vertebrates have a common ancestor.

So, now, I've thrown out a lot of information. I've shown the proposed mechanisms for microevolution and we've looked at evidence for macroevolution. But it doesn't mean anything if I don't accept it. Now, I do accept the theory of evolution as valid, simply because the ideas simply seem to line up. I don't see why, if there was not a common ancestor, there would be so many similarities at the molecular and cellular level of organisms that are in different kingdoms. The fossil record, to me, serves to back that belief up.

As someone with a mathematical background, I tend to accept things based primarily on the reasoning behind them. Now, I recognize that that's probably not the best idea in the other sciences, and it's something I probably need to work on. But that's another reason I think I support the theory: the reasoning behind it simply seems to, for me, line up. I don't see why it shouldn't be true.

Now...off to a #TeachIn11 post! 

Who Would Name Their Kid Erwin?

This is an actual post for the class this blog was originally for. So some of you may want to ignore this, but if you want to read on, feel free.

---

Let's consider three patients: Abby, Bob, and Carol. Their DNA sequences for a particular region of the sequences can be compared to the normal sequence for this region:



ATGGTCCACCTGACTCCTGAGGAGAAGTCTGCC



Each patient has a variant of this.



Abby:



ATGGTCCACCTGACTCCTGAGGTGAAGTCTGCC



Bob:



ATGGTCCACCTGACTCCTGAGGAGTAGTCTGCC



Carol:



ATGGTGCACCTGACCCTGAGCAGAAGTCTGCCC



Each patient has a certain percentage of similarity between their DNA sequence and the normal DNA sequence. For example, Abby's DNA is approximately 96.97% similar to the normal, as is Bob's. Carol, however, has only a 57.58% similarity (assuming order is the only factor considered).

Then, each of these has another side of the chain--its complement. Now, we know that the ratio of adenine to thymine and cytosine to guanine is 1:1. But this raises two questions:  "Why?" and "How did we know this?"

So why? Basically, hydrogen bonds could not form between, say, A and C, or if they did they would be extremely unstable.

Now, how was this originally discovered?

It's a principle known as one of Chargaff's rules and was discovered by Erwin Chargaff. It says that the ratio of purines to pyrimidines (and more specifically, A to T and C to G) is always constant within a species. He discovered this by looking at data similar to the below image:

By analyzing this data, it's not too hard to see that there does seem to be the same amount of adenine and thymine, and cytosine and guanine, within a certain strand of DNA. For example, a rat's DNA seems to be made up of 28.6% adenine and 28.4% thymine, and 21.4% guanine and 21.6% cytosine. As all of these numbers seem to be essentially equal, allowing for experimental error,   for all double-stranded DNA organisms,  it seems quite reasonable to conclude that there is a fixed ratio of these bases. In addition, we also notice that there is an equal division of purines to pyrimidine bases.

How This Blog Works

Since the number of my RSS subscribers has increased significantly (or at least according to FeedBurner--and we know how accurate THAT is) it's probably about time for me to remind everyone that, technically, this is a blog for a class. Over the next week, you will be buried in posts that you probably have no interest whatsoever in.

I would start posting these tonight, but I've just done several hours of English make-up work for the last several days I've missed for various reasons. So...tomorrow.

I'll clearly mark all of them and give you fair warning, and after this week, this blog will pretty much become a personal blog.

Thanks for sticking with me!