Thursday, June 21, 2012

The Year in Review

Over the past school year, I did several things.

I (somehow) passed two different online classes while doing most of the work the week before the respective class reached its conclusion.

I let my motivation fall so low that I was unable to pull it back up for the remainder of the year--to the point where, for most of our fourth quarter, I found myself saying, "I can't wait for next year, because so-and-so-mistake-from-this-year won't happen again!"

I managed, once again, to rewrite a large part of the district "you will take this class this year" flow to satisfy my needs.

I watched my productivity fall below an acceptable level--to the point where only a major scare was able to push it back up to where I wanted it to rest.

And finally, I made a promise to myself that next year, everything will be in overdrive. I've already started my preparations for each different organization I'm running next year, and I have plans in place to finally make a dream of community WiFi a reality.

This year will not happen again. Trust me.

Wednesday, January 4, 2012

Reflections On Myself

So here I am. It's after 11:00 at night, on the last day of break, and what am I doing?

Trying to finish work for school I technically should have done several weeks ago.

Yeah, yeah, I know--bad idea. Believe me, I've heard it all before. You're reading words written by someone who registered for his college classes on Tuesday, January 3rd, when he received the paperwork before Thanksgiving break. I have a habit of minor procrastination. While we're on this topic, it's probably a good time to mention that I have yet to start the coursework for my online AP microeconomics course, all of which is due at the end of this month.

So...why? Why do I consistently do this to myself?

I'm not sure I know the answer. I do feel like I have an overdrive I can turn on when I need it. This summer, I sequenced most of the MIDI files (if you don't know what that is, it's sufficient to know that it's a lot of work) for a local production of The Producers within the space of a week by working from 6:00 A.M. to 11:00 P.M., with breaks only for marching band practices and for rehearsals for my own play, Annie. But, although I do sometimes enjoy cranking out work in this frenzied manner, after a while, it becomes somewhat tiresome.

Do I think I learn more or produce better work when the pressure to finish as quickly as possible is on me? Certainly not. I know that I am far less efficient when I am working like I am right now than I would be if I, as common sense would dictate.

Rarely, I will successfully map out a work schedule for myself, and stick to it, and get whatever it is I'm working on done ahead of time. And it is a nice feeling. But then, I'll lapse back into my old ways. So even though I've tried other solutions, I don't stick with them.

However, the more I think about it, the more I realize that I am, in some aspects, extremely self-motivated. I've engineered and worked on a massive trebuchet, developed a Beowulf cluster, performed some of the harder piano pieces ever written, and made first chair flute in our Allstate band (and believe me, I practiced ahead of time for that). I can work to achieve a goal...sometimes.

Looking through that list, the distinction is obvious: I work on what I want to work on, pushing aside that which bores me (and, let's be honest...compared to a ten foot tall trebuchet, what isn't boring?) for what grabs my attention. Some of my friends here in La Junta don't do this. They prioritize, thinking about what work's due date is closest and therefore should be done first.

Reread that last sentence. Think about it.

Friday, December 9, 2011

We Are Not Alone

I just received an interesting rant via Facebook (excerpts reposted with permission):




"[I'm annoyed about how] some tests are purely memorization and how hardly any intellect is used at all... we just had a biology test that was like that and you could ask me anything about what we just learned and I couldn't tell you simply because I don't know."
 I asked why.
"Basically the test itself is written on the board and everyone can either copy that or literally make a copy of someone elses notes or pure memorization. It's very frustrating, especially when we get to topics that get more complex and you need to know those things from before."
 I empathized, and got:
"The way I see it is grades reflect how much you care rather than how smart you are. I know several people who are smarter/sharper/cleverer than me who don't get very good grades."  


Often times, it feels as though I'm the only person around here who worries about the meaninglessness of grades. I need to remind myself more often that this is not the case. This conversation helped me keep my perspective, and gave me hope that other students share my concerns. And after all, these concerns may be the only thing with the potential or power to bring about change.

Thursday, December 1, 2011

Three Reasons I Hate Grading

Reason 1.

I am tired of overhearing statements like:

"I don't like the teacher, but I love the worksheets."
"That class is an easy A."

Reason 2.

A grade can (huge emphasis on "can") show how much of a curriculum you've mastered. But what happens when you get rid of the curriculum?

Reason 3.

Grades have become all school is about. If we removed the current idea of a "grade," then we could get down to actually learning things.

Tuesday, November 22, 2011

I'm Still Here. And I'm Still Thinking.

First off, an apology. I've learned several things about myself this year, and they tend to be along the lines of "I don't have the energy for this." Between performing in a musical, working in the tech department of our high school, taking nine classes during school, and the typical stresses of being a teenage male...reflecting here has been one of the things pushed onto the back burner.

But I'm back now.



Twice over the past few days, I have found myself trying to explain to others why I don't think worksheets and lectures and droning on and on can really give me the background that I need and want to have.

Then I found something else. Chris Ludwig recently wrote (in this comment on his blog):
"In fact, our job as teachers switches over to being what some are calling “curators” of information, pointing students to some of the best resources. That’s how I see my role at this point in time."
That's going to become my new motto. Teachers should be curators or librarians of knowledge, not mailmen delivering it in packages. When learning becomes oversimplified, it ceases to be learning and becomes memorization.

Tuesday, September 27, 2011

I Hate Schedules

Disclaimer: At the end, I get whiny. Sorry.




Physics. Third hour. It's the class that, right now, I live for.

We've been modifying the designs for our full-size trebuchet, and I'd say that we're about ready to go full scale. You can read another post all about it if you want to. (Our small-scale model is currently capable of flinging a ball bearing approximately 25-30 yards, and we're aiming for one that will launch a pumpkin...a long ways. We won't say how far just yet.)

I'm still somewhat amazed at how well the execution of this class went. After the first week, the entire class had divided itself up into several groups, one working on designing a hovercraft, another on the trebuchet, and another is off in the "corner" playing around with video analysis.

Here's the best part, though: We (both my group and the others floating around) are not confined to a specific workspace (or, for that matter, a specific worktime). In fact, the vast majority of the trebuchet's construction has been done in the unofficial office of myself and another team member.

But like I said earlier...it's third hour. Only third hour. 9:41 to 10:34 (9:17 to 9:59 on Wednesdays).

Every day, I have to go through this, and it's annoying. I can't help but envy Shawn Cornally's class for having 80 minutes to work with--on a good day, my team and I might get forty-five minutes to really work with. Every day, just when we get into the swing of making improvements, the time to leave comes.

Of course, it's not quite as bad as I'm making it sound. I'm in the office at lunch, and quite a few team members have been coming in after school. We do get a chance to develop our ideas, and we're even considering scheduling in some Saturday worktime.

So, let's back up and think about what we have. Here is a group of high school students, working on a project for school as often as they can. No one is forcing us to do this. There's not a grade attached to it. There wasn't a worksheet telling us how to do this. We're doing it because we thought it would be fun.

And once it's built and flinging pumpkins into the field behind the gym, we might just sit down and look at why it works. We'll learn some mechanics while we're at it. We've already had a few mishaps which forced us to sit down and figure out what broke and why, and I've learned the hard way that if you get a TV cart packed with equipment rolling, it will keep rolling, even if you're in the way.

However, I'd still like to see a better way of scheduling classes so that I don't have to pack up my trebuchet every day to go sit in a desk for the rest of the day. So then my question becomes: Why not?

Why not give students time--just time, no strings attached, to work with? Trust me. If you give us the chance, we'll eat it up. We're tired of sitting in desks and doing "activities." And we're tired of not knowing what the things we are doing really mean. In third hour physics, we have a chance to change that. And nothing could be better.

Tuesday, August 30, 2011

A New Year

This blog began as a blog for a class. And although I think that, as I began blogging, keeping this blog with that class blog was appropriate, this year, I'll run it differently.

Here's the link to my physics blog.

And here's my chemistry blog.

(Confession time: I would like to move over to WordPress, but I really don't want to bother with rolling over this blog yet, and really don't want to use two different platforms at the same time. Maybe later.)

Monday, August 8, 2011

Do You Trust Me?

There's been a lot of talk about student-designed education. For example, this post. And, of course, you've all seen Shawn Cornally's TEDx talk.

In case you somehow missed these ideas, they're about giving students less of a rigorous, pre-defined curriculum of things they MUST learn, instead allowing students to take their education where they want to go. (To get the full effect, I really recommend that you go read/watch the original presentations.)

Now, sure, this idea of giving students more control over their education sounds like a great idea--and it is. But it has a major catch: For this to have any chance of working, there has to be--HAS to be--an element of trust between the teacher and student. For this to be implemented on a larger scale, this trust has to exist between students and administration. And to be accepted on that larger scale, this trust has to exist between the public and the students, not to mention the school.

At least where I am, I wouldn't say that this trust really exists--with, of course, a few notable exceptions. Perhaps Chris Ludwig's implementation of a student-designed physics course will help, but that's only with a handful of students. We have to make this work on a larger scale.

If you need more proof that there are apprehensions about loosening restraints on students, look at this letter to the Louisville Courier-Journal. In particular, consider these two paragraphs:
Businesses are governed by their owners and not employees. The school system is governed by rank: teacher, supervisor, principal and superintendent. So where do students fit into this organizational environment? They are at the bottom!

They do not have a voice in what they are required to learn. They do not have the option to decide if they will do an assigned task. They do not have voting rights. They do not have an elected representative to bargain for them. They are to do what they are told, the same as the military, businesses and at home. So when we change our thinking in this matter, we see that the First Amendment of free speech does not apply in any of these situations.

Arnold D. Seligman, the author of this letter, is not arguing for a change in this hierarchy. He is suggesting that this is the proper way things should be. I think it's clear that he does not trust students to take a part in their education.

Somehow, this perception has got to change. How can we make this come about? One obvious solution for the smaller level (trust between students and teachers/administration) is a suggestion box for the school. This would be a chance for students to, if not prove themselves, at least demonstrate that we have valid ideas. For that matter, I'm honestly not sure why we don't have one already. I don't see any valid reason not to.

On the larger level (trust between the public and students), I think students have to start using their voices more. Recently, via Twitter, I've met two other students around the globe doing exactly what I'm doing. Over on Cooperative Catalyst a while back, I read (on a post that I could not find) about a student wanting to start a blog much like this one. And I know that John Burk wants to see his students do this as well.

It won't be a short process. But I think that, with time, it can work. And, I'm afraid, it will have to.  

Saturday, May 28, 2011

"Even our brightest students..." Part II

In a recent post, I spent a lot of time criticizing the attitudes of students--including myself. Even back then, I knew that I was being pretty pessimistic about the future, and that bothered me.

So I tried to find out if my outlook was accurate.

A few things I should say before I start:

The students that I work with have only had--at most--two flavors of standards-based grading. Whenever I refer to SBG in this post, I'm generally referring to Chris Ludwig's approach, because that's the one I've seen in action and debated.

With that out of the way...here's what I've found:

1. Some students agree with me--even though SBG is preferable to a points-based system, it wouldn't be widely accepted.

2. Some students don't like SBG. Period.

So, basically...nothing new. I've been hearing both of those all year, typically when I'm, for some reason, describing SBG in a group setting--and someone else jumps in and says either:

"Yes! I really like standards-based grades!" and then goes on to explain why, or the student will say:

"But standards-based grading [is confusing/kills my grade/is hard]!"

Why is that second response even there? I think the answer is quite simple: students on the whole--especially after over ten years of grades--are so used to viewing a single letter grade as an achievement or as something that communicates some sort of information about them that many simply don't get why that's really not the case.

What I'm about to say has been said many times, but in a summative system--which is basically all I've seen for the past eleven years--grades are developed by building points that often become meaningless. I've heard teachers say, "Now, if you can just remember that the answer to Question 14 is C., you'll get more points for the test." And before this year, I didn't really have a problem with that. But when grades simply become who brought in the most Kleenex and could remember certain answers to a test (and, of course, forget them five minutes later) it's ridiculous to think that they have any meaning.

And the more I think, the more I believe that some students really don't want them to. After all, when we're signing up for the ACT and the SAT (and, after all, that's our only chance to get into a good college), we meet pages like:

 and




Since grades obviously matter so much, students have to get the best ones they can! Right? RIGHT?!?

Now, those of you with incredible memories will recall that, at the beginning of this rambling, I mentioned that there are some students who agree with me--that SBG is preferable to a summative system. And it's these guys that give me hope. I look around and I see classmates' posts (like this one and this one) and I realize that SBG really did bring out a different level of learning in many students--and that they appreciate it.

Students like those two--self-motivated and willing to adapt--are the only reason I believe there is a chance for SBG to become widespread. They know about this idea, support it, and hopefully they will continue to spread it in discussions, like I've been trying to do all year. After all, many people do not know about these non-traditional grading/instruction methods--as I've said before, before the 2010-2011 school year, I had never considered either.1
 

Ok, I've rambled enough by now. Seriously, though, if you don't think I'm giving an accurate representation of students, yell at me. On this issue particularly, I really want to know what you think.





1. Of course, some may suggest that teachers should be forced to use SBG so that we can let more people know about it. I disagree, because I think that, if a teacher is going to make this change, they should make it because they understand the reasons behind it--because they truly believe that the conventional method of assessment is flawed.


Tuesday, May 17, 2011

The "Most Beautiful" Experiment

I'm pretty sure that this will be the last biology post on this blog. You can interpret that as a good thing or a bad thing...I won't tell you which one I think it is.



It's been called the most beautiful experiment in biology. It's just one of those things that it seems like everyone knows about.

I'm referring to, of course, the Meselson-Stahl experiment, showing that DNA replication is semi-conservative.

This experiment's original purpose was to provide data regarding the process of replication of DNA. Watson and Crick's model suggested a way that DNA could replicate, but there wasn't actual information regarding this. So, a few years after Watson and Crick published their model, Meselson and Stahl set out to conclusively establish the method through which DNA replicated.

There were actually several potential models. For example, a DNA molecule could somehow create an entirely new DNA molecule. Or, parts of the DNA could be interspersed with new DNA.

Although Watson and Crick seemed to support the semi-conservative model, where half of the DNA was preserved and the other half was newly created, this model, like all others, was not supported. Meselson and Stahl found a way to provide this support. Here's how:

The key to their experiment was finding a way to tell whether DNA was "old" or newly created, and this was found by labeling the DNA when it was first created. In essence, this was done by growing E. coli bacteria when it was contained in a heavy isotope of nitrogen and another culture in the presence of the ordinary isotope.

After several generations, the bacteria's DNA contained one of the two isotopes of nitrogen. Samples of both cultures--one with the heavy nitrogen, one with the normal--were taken, and the DNA was removed. The DNA from both samples was mixed together, and this solution was mixed with a cesium salt solution which had the same density as DNA.

This final solution of salt and DNA was centrifuged until the cesium ions formed a sediment at the bottom of the tube, causing the solution to be more dense at the bottom than the top. This meant that the DNA formed bands within the tube, with the DNA containing the denser nitrogen closer to the bottom than the DNA with the more common nitrogen.

The process was repeated, but this time, some of the bacteria were allowed to grow in the lighter nitrogen for several generations. This meant that any newly created DNA would have this form of nitrogen included. For every twenty minutes, a sample was taken from this mix of DNA grown in both light and heavy nitrogen. DNA from these samples were centrifuged.

Here were the results: In the first sample (which did not grow in the light nitrogen) all of the DNA contained the "heavy" nitrogen. One generation later, the DNA had an intermediate density between the two. A generation after this, the DNA was half heavy and half light, and as more generations passed, the DNA contained less of the heavy and more of the light.

These results supported semi-conservative reproduction, because they show that part of the DNA is conserved from one generation to the next--otherwise, the DNA synthesized in the lighter nitrogen would only contain the light nitrogen. However, there has to be another part of the DNA that is newly synthesized, because the density of the DNA did not remain at the heavy end of the spectrum.

Now, this experiment is simply wonderfully designed. There was a need--a need to support a model of DNA reproduction, and the hypothesis of semi-conservative reproduction. To test this, there was a variable that was changed--the amount of time that the bacteria were allowed to reproduce within the lighter isotope of nitrogen. Everything else--the speed of the centrifuge, the type of bacteria, the amount of time the bacteria were allowed to grow--was kept constant. There was even a control group--the first group, which did not have any time within the lighter nitrogen.

If you have stayed with me all the way to this point, I want to thank you for putting up with these posts for this long. Although I may have rambled just a few times, and set the world record for worst procrastination, it has been a fun year within this class. 

Tuesday, May 10, 2011

Great American Teach In

What would a perfect learning space look like?

Before I start, I have a confession to make. That's actually a question I've honestly never really considered. I guess I've spent too much time reflecting on what my current learning space looks like--and how I want to make a different one in ten years--to even think about what I think it ought to look like now. There's my little bit of self-reflection done for the day.



So here's what's coming into my mind:

1. Students have a right to know about the various instruction methods available.

I guess this is really my third post (see here and here) in which this idea has made its appearance, but it's an important idea: There are large groups of people out there with no idea what project-based or inquiry-based learning are. Until this school year, I was one of them. I simply didn't know that there were better things out there that I could be getting. Therefore, I never asked for it.

2. Schools should be willing to work for students instead of vice versa when it comes to scheduling.

I know I'm not the only person to write a post on this idea, but it's another idea that matters a lot to me. Students have a certain path that they will end up following, and if this path involves going beyond the typical high school curriculum, they should be able to do it, regardless of "minimum graduation requirements," "only six classes a day," etc.

3. The methods used to assess students should truly assess skills and knowledge.

Oftentimes, students, including myself, get so caught up in what their grade is that we lose sight of whether or not we are truly learning. In a perfect learning system, there would be a correlation between the knowledge and the ways in which the students are objectified. (Of course, my perfect learning system would also be SBAR-based.)

4. Students have a responsibility to provide feedback to their teachers.

Let's be honest: I belong to a generation that, as a whole, is not famous for its communication skills.We (at least around here) need to work on calmly addressing teachers when we have a complaint instead of telling peers about how evil that teacher in Room 304 is.

5. Class sizes are small.

My fourth hour, with Chris Ludwig, has about twenty-five students. Sixth hour is next door, so I often step into his class during this time. On a normal day, there's about ten kids in there, but only three today because all of our seniors are essentially gone. And the one thing that really hit me was the incredible change in atmosphere from fourth hour. It's so much more laid back, relaxed, and open--and it really is a preferable change.

This Post's Title Keeps Evolving, So I'll Just Call It This

I just scrolled through my Twitter stream, and just over the most recent tweets, I saw multiple tweets devoted to just one idea:

#evolution

Although that may not sound too impressive--after all, I follow almost all science teachers--the fact that this one idea is still sparking debates and controversy after centuries of existence is actually pretty impressive when you stop to consider it. Simply clicking on the #evolution hashtag reveals a community that is updated at least once every five to ten minutes.

So what's the real idea behind evolutionary theory?

Let's go back to the beginning...although not the very beginning. Let's start in 1801, when John-Baptiste Lamarck published his Theory of Inheritance of Acquired Characteristics. Right away, if you have a background in evolutionary theory, an alarm bell will go off in your head. If you have that red flag, you've caught the big thing Lamarck got wrong. Lamarck thought that organisms could inherit acquired characteristics. For example, if a snake, throughout the course of its life, develops muscles that allow it to wriggle faster, Lamarck thought that it would pass those muscles on to its offspring.

Darwin didn't think that. He said that organisms pass on mutations, not acquired characteristics. And because organisms pass on mutations, if those mutations give an organism a certain competitive advantage, they have a better chance of producing more offspring. Those offspring may then have the same mutation, which gives them the same advantage over other organisms, giving them a better chance of producing more offspring. These offspring carry the mutation, which gives them an advantage...and the cycle continues.

Now, that's the basic mechanism of the theory of evolution--and it's known as natural selection. It's where phrases like "survival of the fittest" come from. However, that phrase isn't really accurate. Natural selection depends more upon reproduction than survival. Of course, survival helps to reproduce, but it does not guarantee offspring.

The classic, almost cliched, case of evidence for natural selection is the story of the peppered moths in Britain. There are two main phenotypes for this type of moth: light and dark. Before 1848, dark moths made up less than 2% of the total population. However, by 1898, over 95% of moths in industrialized areas were dark.

Why?

The mid-1800s was the time of the Industrial Revolution in Britain. All of those factories were emitting soot, so the landscape itself became somewhat darker. This meant that birds could see the lighter moths more frequently, and so the lighter moths were the ones that were eaten. The darker moths were able to reproduce, which produced more dark moths. Over a period of fifty years, the gene pool of the population changed, which is evolution by definition.

That is an example of microevolution--change within a species--and there are other ways in which this can occur. For example, let's spend some time talking about genetic drift. Genetic drift has to do with the change of the frequency of alleles due to random chance. Genetic drift holds more power in smaller populations, simply because even a slight change in the frequency can have an impact on the overall pool. Essentially, that means:




Genetic drift basically means that some random things will happen to a population to change its gene pool. It boils down to this: If a population is relatively small, then there is an increased chance that rare genotypes will not make it to the next generation.

There's another mechanism for microevolution--gene flow. (Don't worry--this one's much easier to understand than genetic drift!) All that gene flow says is that the migration of organisms has an effect on the gene pool. If two populations share an general boundary, there's nothing to stop them from interbreeding, introducing genes into the gene pool of both populations.



So, that's a little overview of microevolution--change within a species. Now, I realize that I've made some pretty big claims over the last few paragraphs. What evidence is there for those?

It turns out that there's a lot. First off, let's look at the fossil record. I've often been told that there simply aren't any intermediary fossils (fossils of animals that were "in between" species--they have features of both). And the more I research that claim, it's simply not true. For example, look at these fossils:





In these fossils, over a period of 50 million years, we can watch the nostrils move from the front of the skull to their current location at the top of the skull.

Another important branch of evidence for evolution is the idea of homologies. Homologous structures are structures that are shared across many species. For example, even though a cactus and a rose have very different structures that serve as leaves, they both have the same ultimate function. Another example of this is forelimbs among four-legged creatures. Even though, say, a rabbit and a lizard are clearly quite different, the bones within their forelimbs are constructed in the same manner.

Homologies can also be found at the cellular and molecular levels. For example, plant and animal cells are essentially identical--there are only two organelles in a plant cell that are not in an animal cell, and one animal organelle not in a plant. Additionally, a significant percentage of genes are shared across species. Just look at a roundworm and a human. Between those two phenotypically different species, 25% of genes are identical.

Finally, let's look at one more support column for the theory of evolution: the field of embryology. Basically, it says that, in their early stages, embryos of different vertebrates have strong similarities. This is taken to suggest that these vertebrates have a common ancestor.

So, now, I've thrown out a lot of information. I've shown the proposed mechanisms for microevolution and we've looked at evidence for macroevolution. But it doesn't mean anything if I don't accept it. Now, I do accept the theory of evolution as valid, simply because the ideas simply seem to line up. I don't see why, if there was not a common ancestor, there would be so many similarities at the molecular and cellular level of organisms that are in different kingdoms. The fossil record, to me, serves to back that belief up.

As someone with a mathematical background, I tend to accept things based primarily on the reasoning behind them. Now, I recognize that that's probably not the best idea in the other sciences, and it's something I probably need to work on. But that's another reason I think I support the theory: the reasoning behind it simply seems to, for me, line up. I don't see why it shouldn't be true.

Now...off to a #TeachIn11 post! 

Who Would Name Their Kid Erwin?

This is an actual post for the class this blog was originally for. So some of you may want to ignore this, but if you want to read on, feel free.





Let's consider three patients: Abby, Bob, and Carol. Their DNA sequences for a particular region of the sequences can be compared to the normal sequence for this region:



ATGGTCCACCTGACTCCTGAGGAGAAGTCTGCC



Each patient has a variant of this.



Abby:



ATGGTCCACCTGACTCCTGAGGTGAAGTCTGCC



Bob:



ATGGTCCACCTGACTCCTGAGGAGTAGTCTGCC



Carol:



ATGGTGCACCTGACCCTGAGCAGAAGTCTGCCC



Each patient has a certain percentage of similarity between their DNA sequence and the normal DNA sequence. For example, Abby's DNA is approximately 96.97% similar to the normal, as is Bob's. Carol, however, has only a 57.58% similarity (assuming order is the only factor considered).

Then, each of these has another side of the chain--its complement. Now, we know that the ratio of adenine to thymine and cytosine to guanine is 1:1. But this raises two questions:  "Why?" and "How did we know this?"

So why? Basically, hydrogen bonds could not form between, say, A and C, or if they did they would be extremely unstable.

Now, how was this originally discovered?

It's a principle known as one of Chargaff's rules and was discovered by Erwin Chargaff. It says that the ratio of purines to pyrimidines (and more specifically, A to T and C to G) is always constant within a species. He discovered this by looking at data similar to the below image:




By analyzing this data, it's not too hard to see that there does seem to be the same amount of adenine and thymine, and cytosine and guanine, within a certain strand of DNA. For example, a rat's DNA seems to be made up of 28.6% adenine and 28.4% thymine, and 21.4% guanine and 21.6% cytosine. As all of these numbers seem to be essentially equal, allowing for experimental error,   for all double-stranded DNA organisms,  it seems quite reasonable to conclude that there is a fixed ratio of these bases. In addition, we also notice that there is an equal division of purines to pyrimidine bases.

Sunday, May 8, 2011

How This Blog Works

Since the number of my RSS subscribers has increased significantly (or at least according to FeedBurner--and we know how accurate THAT is) it's probably about time for me to remind everyone that, technically, this is a blog for a class. Over the next week, you will be buried in posts that you probably have no interest whatsoever in.

I would start posting these tonight, but I've just done several hours of English make-up work for the last several days I've missed for various reasons. So...tomorrow.

I'll clearly mark all of them and give you fair warning, and after this week, this blog will pretty much become a personal blog.

Thanks for sticking with me! 

Saturday, April 30, 2011

"Even our brightest students suffer with % point systems rather than #sbar"

I wrote my last post while sitting in my hotel room between "workshops" at the Colorado state FBLA conference, so I ran out of the room before throwing it onto Twitter. Then, two of my favorite edu-people out there did it for me, adding their own comments:



 
Then came:








Ever since the small discussion that ensued, in which I stated that I wasn't certain that students would really embrace this change, thoughts on these ideas have been bouncing around my head. And the more time I spend on this, the more certain I am that not everyone would be won over by the idea of SBAR.

Here's the two main reasons I can think of:

Reason 1: At first glance, it translates to more work and more accountability.

An example: I'm in a certain points-based class in which an assignment was supposed to be completed over spring break. It's a pretty important assignment--much of what we have done since then has revolved around it.

I have an "A" (insert eye-roll here) in this class.

And I never did this assignment.

We have accumulated enough points since then that the impact of this missing 25 points has been diluted. From looking at a grade sheet, you'd never know that I was anything but an exemplary worker.

Now, from the way I understand SBAR, there's no way I could pull that off.  My missing work wouldn't have been absorbed by everything else--and students know that. I've often heard someone say, "Oh, I already have all of the points, so it won't matter if I don't know what is going on for the rest of the year." (And that's almost a direct quotation.)

Because kids know that they can hide things they don't understand, many wouldn't want to give this up. After all, grades have become so important to many people (and I have to plead guilty) that often times we resort to "what gets me the best grade is going to be best."

Reason 2: It's new.

There. I said it. Students, at least around here and including myself, tend to be pretty conservative when it comes to massive changes. There was essentially unanimous disappointment ("Oh, man! That is so stupid!") about merging the high school and middle school. Even though it would make practical sense, many students do not want to merge the eight tiny school districts in a thirty-mile radius of La Junta. And multiple times this year, I've heard comments along the lines of, "I hate that new grading system of Ludwig's!" (Of course, then I typically jump in and ask why. I'm then often met with, "I actually have to work.")

The point is that, simply because we've been going along with this system for twelve or thirteen years, able to hide our weaknesses and our struggles, I don't think that we would embrace a change in the opposite direction.

Of course, I could be wrong. Let's hope so. 

Monday, April 18, 2011

Why I'm Glad I'm Doing This

Hopefully, by this point, the posts that I put up here seem to be somewhat thought out. Believe it or not, I do try to spend some time thinking about what goes on here and how efficiently and effectively it communicates with what I'm trying to say.

With that said, I do write these posts in two different ways. There are those that are triggered by some external event, which seem to be written as I watch this event happen, and those that I spend quite a bit of time developing because they explain my preexisting feelings about something.

But as I spend that time thinking about how to communicate my ideas, it's led to a complete paradigm shift. I can't just walk into a classroom anymore; I walk into a classroom thinking, "Oh, boy. Here we go. I get to not really learn anything and watch everyone else do the same."

Is this a good thing?

I suppose, in many ways, it is. After all, if I don't spend any time analyzing learning, I'm not going to be able to shift my own learning/teaching style. Of course, it would probably be preferable for me to find some nice way to tell the teacher that this is my impression of his or her class, but then...how do I tell someone that what he's been doing for longer than I've been alive isn't really that effective for me? I've been able to hide any sub-par learning behind the mask of points for so many years that it is expected that I will be able to excel in any class. Am I really the person to bring this to a discussion?

The answer is probably yes, but I haven't been assertive enough to do this yet.

With my little rant for the day out of the way, however, I really would like to say that I am glad that this year has turned out the way it has. I know so much more now than I did a few months ago--and I know there is a titanic amount left for me to discover.

So why am I here?

I like to think that, first off, I can provide my thoughts. I think that it is important to consider both sides of the desk in education. By doing this, I hope I can provide the perspective of someone who has not been to a teacher's college but still wants to know what can be done to aid students.

This brings me into my next point: Looking around the edublogosphere, I can't help but be a little jealous at what quite a few other students have. I really hope Frank Noschese's students know how lucky they are not to be in a classroom where their itinerary for every day is to watch videos. But because I have this knowledge, if I do end up as a teacher, I will have the tools I will need to avoid this in my own classroom. It's a miniature PLN for a sophomore in high school.

I already do some tutoring, mostly in math, my forte. And in the last month, my style's changed completely. I've gone from, "So here's what you do next" to "So what do you do next?" Although I'm not Dan Meyer yet, I think I've helped a lot more kids in this way--and hope be able to continue refining my ideas.

And that's why I do this.

Thursday, April 7, 2011

Graduating: It's Nice

Well, today, I had to make a few quick decisions, the long term effects of which will be, hopefully, my own high school graduation. To make a long story short, I was supposed to take our school's "World History" class this year, which is, if you want to be nit-picky about it, required for graduation. Somehow, I slipped through the cracks and this class was not on my schedule.

Today, in my monthly meeting with our district's GT advisor (which has, over the year, been christened "Nerd Lunch"), I pointed out this minor technicality and gave what I thought was the best solution. I felt that, since one of the seven classes I would be taking next year would be a class at our community college instead of one on our school's campus, I could then use the open hour this produced to take World History. Basically, I thought I could take eight classes in a day instead of the regular seven.

But of course it couldn't be that easy.

Instead, we ran into more and more scheduling conflicts, and eventually decided that the "best" outcome would be for me to take a "hybrid" course (which, being a different course, is theoretically far more rigorous than World History) through our community college--OJC. This means that, although it would primarily be an online course, I would also have occasional contact with the professor.

So, at this point, I have two main reactions:

Reaction 1:  What will this be like? 


Over the last year, I have learned an incredible amount simply by reading around various edublogs. I have started analyzing every moment I spend in a classroom to see if I am really learning. Of course, this may be getting to the point where it becomes a distraction--but it's a distraction I can live with because it is providing me with the tools I will need if I hope to, one day, be a halfway decent teacher.

Now, as I try out this new medium--a "hybrid" course--I'll be able to carry this newfound insight with me to see how effective it really is. It'll give me a firsthand chance to experience what I try and think about every day, and I'll be able to write about it without having to worry about hurting anyone's (read: a teacher's) feelings because I won't be "learning" from a teacher.

Reaction 2: Is this really the best way?



Bill Ferriter actually said pretty much everything I've been thinking in this post, but I'll go ahead and rehash it. Throughout the entire conversation, we were looking at what I absolutely had to get in before 2013--and it meant a lot of time spent in classes that would probably not be beneficial. Now, we did start to take steps in this direction--we're going to ask the department chair to waive the World History credit for the hybrid course.

But it's not far enough.

If we could keep going in this direction, somehow customizing the curriculum for each student's individual needs and preferences...that's when I think we could get some real work done.

Now, I recognize that, logistically, that's a borderline ridiculous statement. As far as I can see, there's no way to pull that off in a way where every student is in a class beneficial to them--after all, who gets to decide which classes are "beneficial"? Then, even if that could be worked out somehow, we'd have to find a way to actually create a schedule for which that actually worked.

Am I on to something, or am I just an idealistic idiot? 

Structures, But Not Architectural

WARNING: Biology post ahead!



Recently, we've been discussing the components of DNA and how they fit together to create the genetic code. I also found this nice, although admittedly outdated piece [from the University of Arizona ;) !] that aided me in these discoveries.

First off, we have to understand that DNA is a polymer, meaning that it is comprised of several smaller pieces (the monomers) that have joined together. DNA, however, is special, so we can't just call its components monomers--they have their own names. Each monomer is called a nucleotide, and when combined, you get a polynucleotide.

Make sense so far?

Now, there are four nucleotides, and they're all mostly similar. Each one has a 5-carbon sugar (deoxyribose), a phosphate group, and a nitrogenous base. The only difference between the four is in that nitrogenous base. You're probably familiar with the notation for these bases:

A=Adenine
T=Thymine
C=Cytosine
G=Guanine

Let's take some time to examine the bases themselves in more depth.  Two, A and G, are purines, while their counterparts in the DNA sequence, T and C, are pyrimidines. (After a few minutes of Googling...I'm not even going to try to define those terms. I like going in depth, but there's a limit.). Adenine and guanine both have 5 carbon atoms and 4 nitrogen atoms, these atoms are both numbered according to their positions, and both have an NH2 molecule attached to the rings of carbon and nitrogen. The only real difference between these two is that guanine also has an oxygen atom attached to the C6 atom and that the NH2 is at the C6 atom in adenine, while it is found at the C2 atom in guanine.

Cytosine and thymine have are also quite similar to each other, but only consist of one C/N ring, instead of two as the other two bases did. They both have 4 carbon and 2 nitrogen atoms. In fact, the only difference between the two is that thymine has an extra NH2 molecule instead of two oxygen atoms and that guanine has an additional CH3.

We've been focusing on the bases, so let's take some time to examine the backbone, if you will, of DNA--the deoxyribose phosphate. This structure has 5 carbon atoms, two hydroxyl groups, and one lone oxygen atom. These two hydroxyl groups bond with the phosphate groups to build the backbone. This means that there is a polarity to the chain--it goes from 5' to 3'. (Interestingly, compared to ribose, deoxyribose lacks one hydroxyl group, hence the name "DEOXYribose.")

Ok. So, now, we have one side of the DNA chain built. But DNA has a double helix shape, as Watson and Crick discovered. To explain how these sides join and why they twist, we have to examine the bonds within the DNA molecule. First off, when two of the sugar-phosphate "sides" we've been discussing combine, they do so in opposite directions--the two 5' atoms are at opposite ends of the combined chain. Now, along this backbone, the phosphate and sugar are covalently bound--pairs of electrons are shared between the two molecules. The base pairs, however, use hydrogen bonds (remember them? They're caused by charge differences between hydrogen and other atoms.) to join. This is particularly useful because when it is time for them to be separated for RNA synthesis (more on that soon!) these bonds can be easily broken. It is also interesting to note that, although adenine and thymine bond with two bonds, cytosine and guanine use three bonds.

More coming soon! 

Wednesday, April 6, 2011

Synthesizers: They're in Your Cells

This marks two posts in a row for Biology! Don't worry...I have a few personal ones stewing away.



Pretty much everyone knows that DNA is in your cells. That's a well known, widely accepted fact.

Not as many people know that proteins do the dirty work of the body. When you look in the mirror, you are seeing the result of the work of proteins.

But this means that, somehow, the information encoded in your DNA has to be used to make proteins. How is this done?

The answer to this question is the RNA molecule. RNA is somewhat similar to DNA, but it has a few important differences. First off, uracil is used as a base instead of thymine. (Both uracil and thymine are pyrimidines, but uracil is missing a methyl group.) Then, the sugar used in its formation is ribose instead of deoxyribose. RNA also only has one strand instead of DNA's two.

Now, there are three classes of RNA. Let's take some time to examine each.

Messenger RNA (mRNA)


Messenger RNA is what carries the information from DNA to the ribosomes to create proteins. It's almost like the photo negative--every base in RNA is the complement of the base in DNA. For example, a DNA sequence of

ATGTGCA

would be transcribed as

UACACGU

(Remember, RNA uses uracil instead of thymine.)

Then, the strand of mRNA exits the nucleus and heads to the ribosome. Here, it meets up with...

Transfer RNA (tRNA)


Transfer RNA is a single strand of RNA that curls back on itself, with a location for an amino acid. It's typically portrayed in textbooks as a cross-ish shape, like


This isn't the actual shape of tRNA, but this particular representation is useful for several reasons. First off, it shows the "intramolecular base pairing" in the arms of the cross--G and C, U and A. It also is a "charged" RNA, meaning that it is carrying an amino acid. Finally, below the molecule, we can see the "codon," and at the bottom of the molecule itself, we have the "anticodon." Codons are groups of three bases that each have their own specific meaning. (Because there are four possible bases and three bases in a codon, there are 43=64 possible codons.)

Let's track a certain sequence of three bases through transcription (where DNA is transcribed to RNA) to translation (where mRNA is used by tRNA to create an amino acid sequence). Imagine that the sequence AGT is sitting on a DNA molecule. When transcribed to mRNA, it becomes UCA (remember, RNA becomes the complements of the bases in the DNA). This mRNA exits the nucleus and goes to the ribosomes. In the ribosome, it is paired with the tRNA carrying its anticodon, AGU. (As a matter of fact, this would result in the protein serine being added to the chain.)

Then, this general process continues for all of the codons. A series of amino acids is compiled, and finally a protein is made. Now, remember, all of this is happening in the ribosome, and an important part of the ribosome is

Ribosomal RNA (rRNA)


The ribosome is comprised of two subunits, both composed of rRNA. These two components are creatively known as the who on earth named these things large subunit (LSU) and the small subunit (SSU). When mRNA enters the ribosome for translation, it slides between the two subunits. Ribosomes have three binding sites for tRNA to enter as the mRNA is translated (known as A, P, and E). The A site binds with a charged tRNA--one that is carrying an amino acid. At the P site, another charged tRNA is waiting--and the amino acids of the P tRNA and the A tRNA bond. The tRNA that was at the P site moves to the E site, leaving its amino acid behind, and the molecule occupying the A site moves to the P site. Another tRNA molecule comes in to the A site, and the cycle continues.

That's a brief overview of the various types of RNA!



I have a confession: Over the past month, my writing on science stuff has seemed increasingly dry. I haven't liked it, and I don't know why. Has anyone else noticed this?

Tuesday, March 29, 2011

Community Meeting on School Budget

Well, I've just come from a "community budget forum" regarding the various cuts that will have to be made to cover a $900,000 shortfall in our district's budget. (You can find all of the in-depth data here.) I was actually in the process of shifting my weight to get up to talk when the meeting was adjourned. (My dad joked that they saw me coming.) So, since I didn't say it in public, I'll say what I had to say here. (Don't worry. It's not much.)

Although many of the cuts presented were just that--cuts that would result in loss of students, teachers, and/or other personnel and activities--a couple of "cuts" seem to be, to me, beneficial. For example, one possible option was combining Reading and Writing classes (which are offered separately in grades 4-8) into one English or Language Arts class. 

I've heard arguments for both sides. But I think that this move has the potential to deepen a student's understanding of literature and the English language in general. It gives students a chance to see the big picture and how everything ties together in the end. For example, a class can look at particular styles of language, and then see how they have been used in literary works. Unless the two separate classes are exceptionally well coordinated, they cannot play off of each other in this manner--and if they are this well coordinated, what's the point of having two?

Then, another potential "cut" would be the loss of the NWEA test. Multiple times a year, we lose classroom time to this computerized test. Of course, the reason this was frowned upon at the meeting was the loss of "data" about students. (Insert eye roll here.) Really--that score is just a number. In all reality, it doesn't mean that much. It just leads to more stress among students and staff alike, and I would not lose sleep if it went bye-bye.

Finally, the possibility of undepartmentalizing our fourth and fifth grades was also mentioned.1 I was never a fan of this idea, because I do not feel that students of this age are developmentally ready for these conditions. My mother passed away when I was in fourth grade, and my teacher was incredibly supportive of me in this time. However, younger students don't have as close relationship with teachers, and in similar situations, cannot receive this support.

Well, I'm afraid that's all for this time. I didn't have much to say at the meeting tonight, and I just wanted to get what I did out there!



1. Although this is probably technically a teacher reduction, I would not mind seeing this implemented in a way that did not cause this loss. With student to teacher ratios well over 20:1 for most of the district, we can certainly use as many teachers as we can afford to keep.